DNA: Counting DNA Nucleotides | Ben Cunningham

DNA: Counting DNA Nucleotides

Problem by Rosalind · on July 1, 2012

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of a length 21 DNA string (whose alphabet contains the symbols ‘A’, ‘C’, ‘G’, and ‘T’) is “ATGCTTCAGAAAGGTCTTACG.”

Given: A DNA string of length at most 1000 nt.

Return: Four integers (separated by spaces) counting the respective number of times that the symbols ‘A’, ‘C’, ‘G’, and ‘T’ occur in .

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21

R

library(magrittr)

f <- "dna.txt"
sym <- c("A", "C", "G", "T")

readLines(f) %>%
  strsplit(split = "") %>%
  table() %>%
  .[sym] %>%
  unname() %>%
  cat()
20 12 17 21